ID: 1049743835_1049743846

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1049743835 1049743846
Species Human (GRCh38) Human (GRCh38)
Location 8:144254682-144254704 8:144254734-144254756
Sequence CCAGCTGGCTGCAGCTGAGCCTG GGTCCACGGCACCCAGGTGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 59, 4: 428} {0: 1, 1: 0, 2: 0, 3: 9, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!