ID: 1049749485_1049749495

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1049749485 1049749495
Species Human (GRCh38) Human (GRCh38)
Location 8:144276541-144276563 8:144276577-144276599
Sequence CCGGGGCCTCTGTCCCTGGGCTG GCTAGACACGGAAGCCACTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 82, 4: 852} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!