ID: 1049752419_1049752425

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1049752419 1049752425
Species Human (GRCh38) Human (GRCh38)
Location 8:144291519-144291541 8:144291540-144291562
Sequence CCGGGGACCAGGGCGGGGTCGGG GGGCCTGCGTGCTCGCGCCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 56, 4: 443} {0: 1, 1: 0, 2: 0, 3: 10, 4: 98}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!