ID: 1049777558_1049777564

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1049777558 1049777564
Species Human (GRCh38) Human (GRCh38)
Location 8:144413634-144413656 8:144413649-144413671
Sequence CCCAGATCACCGCGGGAGGCGGA GAGGCGGAGCCGCAGGCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 48} {0: 1, 1: 0, 2: 2, 3: 39, 4: 382}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!