ID: 1049788578_1049788592

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1049788578 1049788592
Species Human (GRCh38) Human (GRCh38)
Location 8:144462777-144462799 8:144462821-144462843
Sequence CCGCCGCCTCAGTGGGCCCGGCC CGCGGCCACCGACCCCGGCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 255} {0: 1, 1: 0, 2: 1, 3: 10, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!