ID: 1049800240_1049800250

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1049800240 1049800250
Species Human (GRCh38) Human (GRCh38)
Location 8:144514304-144514326 8:144514330-144514352
Sequence CCCGCCCCCACCAGTGCCTCAGG CAGCATCAGCACGTGTACCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 49, 4: 558} {0: 1, 1: 0, 2: 2, 3: 6, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!