ID: 1049803231_1049803241

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1049803231 1049803241
Species Human (GRCh38) Human (GRCh38)
Location 8:144527697-144527719 8:144527738-144527760
Sequence CCGCAGGGCGAGAGGAAGGGGAA GCTGCGGTTGGGTCTCAGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 430} {0: 1, 1: 0, 2: 0, 3: 24, 4: 217}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!