ID: 1049803512_1049803534

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1049803512 1049803534
Species Human (GRCh38) Human (GRCh38)
Location 8:144528837-144528859 8:144528888-144528910
Sequence CCCCCATCCCCGCTGCAGGCCCG GTCCGGAGCGTCCCGCAAGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 417} {0: 1, 1: 0, 2: 0, 3: 1, 4: 23}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!