ID: 1049820726_1049820738

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1049820726 1049820738
Species Human (GRCh38) Human (GRCh38)
Location 8:144631666-144631688 8:144631713-144631735
Sequence CCTGGTGTAAGCACCTCTGGGTC AGAAACCTGTGCAGAGGGAAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!