ID: 1049834001_1049834007

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1049834001 1049834007
Species Human (GRCh38) Human (GRCh38)
Location 8:144721346-144721368 8:144721383-144721405
Sequence CCCAGAGCACCAGCTGGGCTCAC ATCCATTCGTCATGAGTATCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 250} {0: 1, 1: 0, 2: 0, 3: 5, 4: 38}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!