ID: 1049844157_1049844172

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1049844157 1049844172
Species Human (GRCh38) Human (GRCh38)
Location 8:144792091-144792113 8:144792125-144792147
Sequence CCCGGCGCCCTTCCTCTGTCCAC CCCATGGCGACGGGTCCTGGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 29, 4: 287} {0: 1, 1: 0, 2: 2, 3: 9, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!