ID: 1049844160_1049844166

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1049844160 1049844166
Species Human (GRCh38) Human (GRCh38)
Location 8:144792098-144792120 8:144792115-144792137
Sequence CCCTTCCTCTGTCCACGGATCAC GATCACACGGCCCATGGCGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 22, 4: 191} {0: 1, 1: 0, 2: 0, 3: 2, 4: 53}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!