ID: 1049844163_1049844178

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1049844163 1049844178
Species Human (GRCh38) Human (GRCh38)
Location 8:144792103-144792125 8:144792152-144792174
Sequence CCTCTGTCCACGGATCACACGGC TCACGATTAGCGCGGCCGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 84} {0: 1, 1: 0, 2: 0, 3: 0, 4: 15}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!