ID: 1049855955_1049855957

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1049855955 1049855957
Species Human (GRCh38) Human (GRCh38)
Location 8:144862015-144862037 8:144862058-144862080
Sequence CCGGGGGATAATATGTGTGAGGA CTTTTCAGTAGTAGTAGTAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 13, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!