ID: 1049886674_1049886681

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1049886674 1049886681
Species Human (GRCh38) Human (GRCh38)
Location 9:31859-31881 9:31874-31896
Sequence CCTGCCTTTGCTGGCCAGCTGGG CAGCTGGGCTGAGCGGGCCTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!