ID: 1049894904_1049894916

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1049894904 1049894916
Species Human (GRCh38) Human (GRCh38)
Location 9:104118-104140 9:104166-104188
Sequence CCCCCATCGCAAGGGGGTGAGAC GCCAGCCCCTCTTCCCTCCCTGG
Strand - +
Off-target summary {0: 1, 1: 8, 2: 27, 3: 60, 4: 191} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!