ID: 1049899895_1049899899

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1049899895 1049899899
Species Human (GRCh38) Human (GRCh38)
Location 9:149428-149450 9:149450-149472
Sequence CCCTACTCCATCTGTAAAAGCCT TTATTCATTCTTTAAGACTCAGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 0, 3: 15, 4: 182} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!