ID: 1049905456_1049905460

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1049905456 1049905460
Species Human (GRCh38) Human (GRCh38)
Location 9:212695-212717 9:212735-212757
Sequence CCTAACCTTCATGGTTAGGTACC CAGTATGATCTGAGGCAAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 52} {0: 1, 1: 0, 2: 1, 3: 17, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!