ID: 1049936347_1049936360

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1049936347 1049936360
Species Human (GRCh38) Human (GRCh38)
Location 9:504692-504714 9:504733-504755
Sequence CCCGAGCTCCGGGTCCGCGGCGG AGGTTGGGAGGAGCGGCCGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 159} {0: 1, 1: 0, 2: 0, 3: 12, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!