ID: 1050101275_1050101278

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1050101275 1050101278
Species Human (GRCh38) Human (GRCh38)
Location 9:2122727-2122749 9:2122744-2122766
Sequence CCAATTTCAGTATGGTAGAACCA GAACCAAAGGAAGAAGGAAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 11, 3: 169, 4: 2124}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!