ID: 1050116051_1050116061

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1050116051 1050116061
Species Human (GRCh38) Human (GRCh38)
Location 9:2264560-2264582 9:2264607-2264629
Sequence CCCTGCCGGATCCGGAGGGGTGG AGGCAATCAGCAGCAGTGGATGG
Strand - +
Off-target summary {0: 14, 1: 74, 2: 165, 3: 149, 4: 153} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!