ID: 1050116053_1050116058

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1050116053 1050116058
Species Human (GRCh38) Human (GRCh38)
Location 9:2264561-2264583 9:2264584-2264606
Sequence CCTGCCGGATCCGGAGGGGTGGA AGTCAGCAGTGGGTCTGCGACGG
Strand - +
Off-target summary {0: 12, 1: 72, 2: 148, 3: 164, 4: 147} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!