ID: 1050117110_1050117118

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1050117110 1050117118
Species Human (GRCh38) Human (GRCh38)
Location 9:2274631-2274653 9:2274681-2274703
Sequence CCCAGAACTTGGAAGTGATTCTG TATTATATTTAAAAAGTGGGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 17, 4: 297} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!