ID: 1050158256_1050158257

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1050158256 1050158257
Species Human (GRCh38) Human (GRCh38)
Location 9:2690769-2690791 9:2690785-2690807
Sequence CCAGAATCAAGGTATCAGCAGAG AGCAGAGTTTATTTCTTTTCAGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 49, 3: 304, 4: 1217} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!