ID: 1050171555_1050171563

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1050171555 1050171563
Species Human (GRCh38) Human (GRCh38)
Location 9:2824749-2824771 9:2824798-2824820
Sequence CCACTCTGGCGCCATCGTGTGTG GATGGCTTCAATCATTTCCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 146} {0: 1, 1: 0, 2: 0, 3: 14, 4: 214}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!