ID: 1050206095_1050206098

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1050206095 1050206098
Species Human (GRCh38) Human (GRCh38)
Location 9:3197834-3197856 9:3197869-3197891
Sequence CCACATTTGAAGGAGGCATCTCC GTCGAGTTTTACATTTTAAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 2, 3: 36, 4: 361}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!