ID: 1050310118_1050310121

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1050310118 1050310121
Species Human (GRCh38) Human (GRCh38)
Location 9:4344189-4344211 9:4344207-4344229
Sequence CCCGATAAAATTCATATTCACCA CACCATTTTTATTTGCCCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 254} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!