ID: 1050366993_1050367000

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1050366993 1050367000
Species Human (GRCh38) Human (GRCh38)
Location 9:4881915-4881937 9:4881968-4881990
Sequence CCCTAGATCAATCCTGGGGAAGA CACACACAAACCAATCATTGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 37, 4: 245}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!