ID: 1050374910_1050374914

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1050374910 1050374914
Species Human (GRCh38) Human (GRCh38)
Location 9:4960650-4960672 9:4960666-4960688
Sequence CCCTCCTGCTTCAGTTTCCCCAG TCCCCAGTAGCTAGGACTACAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 29, 3: 207, 4: 1386} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!