ID: 1050480414_1050480420

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1050480414 1050480420
Species Human (GRCh38) Human (GRCh38)
Location 9:6081920-6081942 9:6081944-6081966
Sequence CCTCTTTTATTTTGAGTCCCACC GGAGCCCTTGATAAATTTGGAGG
Strand - +
Off-target summary No data {0: 12, 1: 8, 2: 19, 3: 32, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!