ID: 1050506747_1050506750

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1050506747 1050506750
Species Human (GRCh38) Human (GRCh38)
Location 9:6356640-6356662 9:6356660-6356682
Sequence CCACTATTAAACATTAGCCATTA TTATTACCAAAGATTGCCCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 8, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!