ID: 1050535047_1050535051

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1050535047 1050535051
Species Human (GRCh38) Human (GRCh38)
Location 9:6623743-6623765 9:6623783-6623805
Sequence CCATTGAAAGTTTAGGAAATAAG CACATCTGAGAAGATAGGCAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 17, 4: 233}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!