ID: 1050592296_1050592303

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1050592296 1050592303
Species Human (GRCh38) Human (GRCh38)
Location 9:7173337-7173359 9:7173360-7173382
Sequence CCCTGCAACTGATGCCGTCTGAG CAGAGCACGGGGCAGGCTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 71} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!