ID: 1050617222_1050617232

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1050617222 1050617232
Species Human (GRCh38) Human (GRCh38)
Location 9:7414388-7414410 9:7414440-7414462
Sequence CCTGCCCTGCCTCCATCCATCAG AGTAGAAAAGAGGTGGTAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 71, 4: 753} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!