ID: 1050735871_1050735875

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1050735871 1050735875
Species Human (GRCh38) Human (GRCh38)
Location 9:8762614-8762636 9:8762655-8762677
Sequence CCTCTTTTAAAATTAATGGCCTG TCAGGAAAAGAAATATTTATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 261} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!