ID: 1050742728_1050742732

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1050742728 1050742732
Species Human (GRCh38) Human (GRCh38)
Location 9:8841035-8841057 9:8841066-8841088
Sequence CCATGGCTACAGAGTGGTGAGGA TGGACTATTAAATCTTTCTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 15, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!