ID: 1050889482_1050889486

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1050889482 1050889486
Species Human (GRCh38) Human (GRCh38)
Location 9:10806196-10806218 9:10806239-10806261
Sequence CCTCTTTTCACTCAGTTCCTGCC CTAATAATTCCTACTATCATAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 1, 3: 52, 4: 490} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!