ID: 1051029481_1051029484

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1051029481 1051029484
Species Human (GRCh38) Human (GRCh38)
Location 9:12657699-12657721 9:12657727-12657749
Sequence CCATGAAGGGAAACTGGATTGGA GGCAACATTCCCAACACCCAGGG
Strand - +
Off-target summary {0: 6, 1: 6, 2: 7, 3: 36, 4: 182} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!