ID: 1051035188_1051035191

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1051035188 1051035191
Species Human (GRCh38) Human (GRCh38)
Location 9:12736053-12736075 9:12736093-12736115
Sequence CCCAATTCCATCTGCTTGCACTC GCTTTACATGTGATACCTGTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 8, 4: 100}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!