ID: 1051041313_1051041318

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1051041313 1051041318
Species Human (GRCh38) Human (GRCh38)
Location 9:12815642-12815664 9:12815678-12815700
Sequence CCTGCTTTTATCTGACTAGTTGA AAGGGTAACAATAATGGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 114} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!