ID: 1051071654_1051071658

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1051071654 1051071658
Species Human (GRCh38) Human (GRCh38)
Location 9:13175699-13175721 9:13175713-13175735
Sequence CCCCTTGTCAAGGGGGTTGAGGA GGTTGAGGAGTAGGTATATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 124} {0: 1, 1: 0, 2: 1, 3: 12, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!