ID: 1051199212_1051199222

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1051199212 1051199222
Species Human (GRCh38) Human (GRCh38)
Location 9:14598078-14598100 9:14598114-14598136
Sequence CCCACCGACCTCTCTGGCCCACT GCCCAGAGCAAGCTGCCTGGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!