ID: 1051199214_1051199222

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1051199214 1051199222
Species Human (GRCh38) Human (GRCh38)
Location 9:14598082-14598104 9:14598114-14598136
Sequence CCGACCTCTCTGGCCCACTGCCT GCCCAGAGCAAGCTGCCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 67, 4: 518} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!