ID: 1051210546_1051210549

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1051210546 1051210549
Species Human (GRCh38) Human (GRCh38)
Location 9:14737763-14737785 9:14737789-14737811
Sequence CCAGTCCAATTCTAGCTCTACCA ACTTGCTAGATGAGCATCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 123} {0: 1, 1: 0, 2: 2, 3: 9, 4: 166}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!