ID: 1051215803_1051215814

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1051215803 1051215814
Species Human (GRCh38) Human (GRCh38)
Location 9:14796108-14796130 9:14796156-14796178
Sequence CCATAATGCTTTTTAAGAACCTT GATATGGGGCAGATAAGGAAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!