ID: 1051238940_1051238942

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1051238940 1051238942
Species Human (GRCh38) Human (GRCh38)
Location 9:15031440-15031462 9:15031469-15031491
Sequence CCAAGACATTCATGGGGCTCGCT TGATGTTCACTTTATTGTGGTGG
Strand - +
Off-target summary No data {0: 2, 1: 14, 2: 60, 3: 184, 4: 781}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!