ID: 1051261842_1051261845

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1051261842 1051261845
Species Human (GRCh38) Human (GRCh38)
Location 9:15272316-15272338 9:15272339-15272361
Sequence CCTAGTGCTCCTCCAGTGTTGGT TTCCCTTAGCTCCCCAGTACTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!