|
Left Crispr |
Right Crispr |
| Crispr ID |
1051272086 |
1051272099 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
9:15365514-15365536
|
9:15365557-15365579
|
| Sequence |
CCCACCGGACCCAGAAGCCCAGC |
GCACTTTGGGAGGCCGATGCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 11, 1: 234, 2: 389, 3: 1303, 4: 1033} |
{0: 366, 1: 88627, 2: 228377, 3: 238400, 4: 154794} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|