ID: 1051272091_1051272102

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1051272091 1051272102
Species Human (GRCh38) Human (GRCh38)
Location 9:15365531-15365553 9:15365571-15365593
Sequence CCCAGCCAGCTTCACCTCAGACA CGATGCAGGTGGATCACCTGAGG
Strand - +
Off-target summary No data {0: 33, 1: 6542, 2: 28555, 3: 60311, 4: 86678}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!