ID: 1051272091_1051272103

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1051272091 1051272103
Species Human (GRCh38) Human (GRCh38)
Location 9:15365531-15365553 9:15365575-15365597
Sequence CCCAGCCAGCTTCACCTCAGACA GCAGGTGGATCACCTGAGGTCGG
Strand - +
Off-target summary No data {0: 1812, 1: 5413, 2: 9643, 3: 10748, 4: 11219}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!